1. Introduction
Pseudomonas aeruginosa is a Gram-negative bacterium responsible for several nosocomial infections, especially in immunosuppressed patients, burn patients, and cystic fibrosis patients [1]. This pathogen has acquired antibiotic-resistance mechanisms, such as reduced outer-membrane permeability, overexpression of efflux pumps, antibiotic-resistance enzymes such as β-lactamases, and biofilm formation. P. aeruginosa has been recognized as one of the World Health Organization's priority bacteria, which requires serious research and therapeutic attention [2,3].
Imipenem (IMP) is a wide-spectrum carbapenem antibiotic with bactericidal activity against various Gram-negative bacteria. This antibiotic destroys the bacterial cell wall by binding to penicillin-binding proteins (PBPs). It is stable against most β-lactamases, making it an important medicine for severe and multidrug-resistant bacterial infections.
Quorum sensing (QS), a communication system in bacteria, assists bacteria in communicating with each other based on population density, directing both the expression of genes that produce toxins and the structure of biofilm production in P. aeruginosa [4–6]. Within the interconnected QS systems of this pathogen, the LasI/LasR and RhlI/RhlR QS systems regulate the majority of gene expression for toxins and other virulence factors responsible for biofilm development [6,7]. The regulators LasR and RhlR are both part of the LuxR family of transcriptional regulators and, when autoinducers (acyl-homoserine lactones) bind to these regulators, they activate the expression of genes encoding different virulence factors — e.g. elastase, pyocyanin, rhamnolipids, and exopolysaccharides — contributing to biofilm maturation and structural integrity [6,7]. The lack of either LasR or RhlR has been shown to significantly reduce biofilm formation and lessen the degree of tissue destruction of human epithelial cells, indicating that QS signaling is strongly associated with host–pathogen interactions [6].
The biofilm matrix is a primary mechanism of antibiotic resistance because the polysaccharide matrix limits antibiotic uptake and creates a group of metabolically inactive cells called persisters [8,9]. Furthermore, P. aeruginosa has several mechanisms to attach to human epithelial cells, employing pili, flagella, and lectins, which constitute the first step in colonizing a human host and leading to chronic infection [1,10,11].
Despite growing evidence of the correlation between QS, biofilm formation, and adhesion to biotic surfaces, the specific correlation between IMP resistance and LasR/RhIR-dependent biofilm and adhesion to human epithelial cells is scantily covered in the literature. Therefore, the present study aims to investigate the association between resistance to IMP, the LasR/RhIR QS genes, biofilm production, and attachment to human epithelial cells in P. aeruginosa isolates from infected burn wounds.
2. Materials and Methods
2.1 Bacterial Isolates
The present study is cross-sectional and descriptive-analytical. One hundred swabs were collected from burn wound infections of indoor patients residing in the Baghdad Teaching Hospital and Burn Center, Baghdad, Iraq. The samples were inoculated onto MacConkey agar, and the non-lactose-fermenting isolates were re-cultured on cetrimide agar. Biochemical tests (oxidase, catalase, and pigment production test) were performed. The VITEK II system (bioMérieux, France) was used to confirm bacterial species identification. Purified bacterial growth was stored short-term by inoculation onto nutrient agar plates and kept at 4°C for one week. For long-term storage, isolates were suspended in 20% glycerol in nutrient broth and kept at −20°C for up to one year [12,13].
2.2 Biofilm Formation
The microdilution and spectrophotometric methods, post-staining with 0.1% crystal violet, were applied to assess the ability of different P. aeruginosa isolates to form biofilms on polystyrene surfaces. Briefly, 100 µL of Tryptic Soy Broth (TSB, HiMedia, India) containing 0.5% glucose was added to each sterile flat-bottom well. Five microliters of standard inoculum of bacterial suspension (optical density 0.1 at 600 nm) were added to each well. The plates were incubated at 37°C for 24 h. Wells were washed gently with distilled water and incubated for 1 h at 65°C to dry and fix the biomass. One hundred microliters of 1% crystal violet (HiMedia, India) were added to the wells and incubated at 21°C for 16 min, then washed in triplicate with distilled water. The plates were dried, and 100 µL of absolute ethanol (99%, Fluka, UK) was added to the wells. The optical density at 590 nm was measured using a Bio-Rad microplate reader (USA) [14].
2.3 Adhesion to Human Epithelial Cells
To evaluate the ability of P. aeruginosa isolates to adhere to human epithelial cells, human oral mucosal epithelial cells (OMECs) were employed. The isolation and preparation of these cells were described in detail previously [14]. Human OMECs were seeded in a sterile 24-well tissue culture plate using Dulbecco's Modified Eagle Medium (DMEM) supplemented with 10% fetal calf serum (final volume: 1 mL per well). One hundred microliters of bacterial suspension (107 CFU/mL) were added to each well. Plates were incubated for 2 h at 37°C. After incubation, the human OMECs were harvested and washed four times with sterile phosphate-buffered saline (PBS; pH 7.2; 0.1 M). The final volume was adjusted to 1 mL with PBS, and the solution was divided into two parts. The first was mixed with Triton X-100, and viable bacterial counts were measured by plate count. The second was used to prepare slides stained with Leishman stain to visualize and count the bacteria attached to each human epithelial cell using a Carl Zeiss light microscope. A smartphone (Honor 400) was used to photograph the preparations.
2.4 LasR and RhIR Gene Detection
Bacterial DNA was extracted using an extraction kit (iNtRON Biotechnology, Korea) following the manufacturer's instructions. The purity of extracted DNA was verified spectrophotometrically (A260/280 nm). Table 1 shows the primers used to target the lasR and rhlR genes, which were synthesized by Macrogen Inc. (Korea). PCR was performed in a twenty-microliter reaction containing 8 µl Master Mix (SYNTOL, Russia), 2 µl primer mix, 7.5 µl MgCl₂, 0.5 µl nuclease-free water, and 2 µl template DNA. The thermal cycling conditions were: initial denaturation at 94°C for 5 min; 35 cycles of 94°C for 30 s, 55°C for 30 s, and 72°C for 30 s; and a final extension at 72°C for 5 min. Amplicons were resolved on a 1.5% agarose gel stained with ethidium bromide, electrophoresed at 160 V for 40–50 min alongside a 100-bp ladder, and visualized under UV transillumination.
Table 1. PCR primers and their sequences, with positions and amplicon lengths for the forward and reverse primers (Grosso-Becerra et al., 2014).
| Amplicon | Primer | Sequence 5′–3′ | Position | Length (bp) |
|---|---|---|---|---|
| RhIR | rt_rhlR-F2 | CTGGGCTTCGATTACTACGC | 112 | 124 |
| rt_rhlR-R2 | CCCGTAGTTCTGCATCTGGT | 215 | ||
| LasR | rt_lasR-F | CGGTTTTCTTGAGCTGGAAC | 15 | 100 |
| rt_lasR-R | GCCGAACAGGATCTTCGAG | 114 |
2.5 Statistical Analysis
The Origin 8 software was used for statistical analysis. Data are presented as means ± standard deviation. Differences were evaluated using a Student t-test and one-way ANOVA. Correlation coefficient values were also calculated. A value of P < 0.05 was considered statistically significant.
3. Results
3.1 Bacterial Isolates, Susceptibility and Biofilm Formation
Table 2 shows the P. aeruginosa response to imipenem (IMP). The results showed that five isolates (45.5%) were resistant, one isolate (9.1%) was intermediate, and five isolates (45.5%) were susceptible to IMP based on the diameter of the inhibition zone. Five isolates (45.5%) were categorized as strong biofilm producers, a similar number exhibited moderate biofilm formation, and only one isolate (9.1%) was categorized as a weak biofilm producer. It was observed that all imipenem-resistant isolates (PA1, PA2, PA6, PA7, and PA10) showed strong biofilm formation, with OD590 values ranging from 0.414 to 0.525. In contrast, susceptible isolates exhibited moderate or weak biofilm formation, suggesting a positive association between IMP resistance and biofilm formation.
Table 2. The imipenem (IMP) susceptibility of eleven isolates of P. aeruginosa isolated from infected burn wounds. The table presents the diameter of the inhibition zone in millimeters, susceptibility interpretations, optical density (OD) at 590 nm corresponding to biofilm formation, and categorization of biofilm-forming isolates.
| No | Isolate | Inhibition Zone Diameter (mm) | Interpretation | Biofilm OD590 | Biofilm Category |
|---|---|---|---|---|---|
| 1 | PA1 | 12.15 ± 1.9 | Resistant (R) | 0.414 ± 0.12 | Strong |
| 2 | PA2 | 8.7 ± 2.4 | Resistant (R) | 0.525 ± 0.09 | Strong |
| 3 | PA3 | 32.5 ± 3.9 | Susceptible (S) | 0.216 ± 0.012 | Moderate |
| 4 | PA4 | 31.9 ± 4.2 | Susceptible (S) | 0.193 ± 0.1 | Weak |
| 5 | PA5 | 28.6 ± 3.8 | Susceptible (S) | 0.262 ± 0.089 | Moderate |
| 6 | PA6 | 11.5 ± 2.1 | Resistant (R) | 0.485 ± 0.14 | Strong |
| 7 | PA7 | 9.1 ± 0.9 | Resistant (R) | 0.45 ± 0.11 | Strong |
| 8 | PA8 | 17.2 ± 0.8 | Intermediate (I) | 0.319 ± 0.09 | Moderate |
| 9 | PA9 | 19.1 ± 1.1 | Susceptible (S) | 0.327 ± 0.13 | Moderate |
| 10 | PA10 | 12.2 ± 1.9 | Resistant (R) | 0.455 ± 0.103 | Strong |
| 11 | PA11 | 22.3 ± 2.1 | Susceptible (S) | 0.31 ± 0.12 | Moderate |
Bold rows indicate IMP-resistant isolates selected for adhesion and PCR analysis. OD, optical density.
To support the results of Table 2, the correlation coefficient was calculated between biofilm formation and susceptibility to imipenem as measured by the diameter of the inhibitory zone across all eleven P. aeruginosa isolates. A high negative correlation was observed (r = −0.84, P < 0.005) (Fig. 1). The isolates with higher biofilm formation exhibited smaller inhibition zones, indicating greater IMP resistance. Enhanced biofilm production contributes to decreased antibiotic susceptibility.
3.2 Bacterial Adhesion to Human OMECs
The ability of three IMP-resistant, strong biofilm-producing isolates to adhere to human OMECs was assessed in vitro. Fig. 2a shows the viable adhered bacteria (CFU/mL) of selected P. aeruginosa isolates to human OMECs. Fig. 2b shows the mean number of visualized adhered bacteria (total adhered bacteria) per epithelial cell as determined by microscopic examination. Isolates exhibiting higher viable counts also showed a higher number of visualized adhered bacteria per human OMEC, indicating that the enhanced adhesive capacity is variable and isolate-dependent. These results indicate a correlation between bacterial adherence to a biotic surface, ability to produce biofilm, and resistance to imipenem, as the isolates PA2, PA6, and PA10 are highly resistant to IMP and strongly produce biofilm.
Fig. 3 further supports the finding that P. aeruginosa has a high ability to adhere to human OMECs, indicating that these isolates may be highly virulent, as adhesion to epithelial cells constitutes the first step of infection.
3.3 QS Genes Distribution
Fig. 4 shows the agarose gel electrophoresis image confirming the presence of QS genes in the three selected isolates. Both genes were found in all three P. aeruginosa isolates shown in Fig. 4. The lasR gene amplicon was approximately 150 bp (Fig. 4a), while the rhlR amplicon was approximately 220 bp.
Table 3 shows the PCR screening results for all 11 P. aeruginosa isolates. The lasR gene was detected in 8 out of 11 isolates (72.7%). The rhlR gene was more prevalent, detected in 9 out of 11 isolates (81.8%) and absent in only two isolates (18.2%). Both QS genes were simultaneously present in 8 isolates (PA1, PA2, PA6, PA7, PA8, PA9, PA10, and PA11) (72.7%). Both genes were absent in two isolates (PA3 and PA4) (18.2%).
Table 3. Variations in the presence of QS genes (lasR and rhlR) among 11 isolates of P. aeruginosa. Genes were detected by PCR. +, presence of gene; −, absence of gene.
| No | Isolate | lasR Gene | rhlR Gene |
|---|---|---|---|
| 1 | PA1 | + | + |
| 2 | PA2 | + | + |
| 3 | PA3 | − | − |
| 4 | PA4 | − | − |
| 5 | PA5 | − | + |
| 6 | PA6 | + | + |
| 7 | PA7 | + | + |
| 8 | PA8 | + | + |
| 9 | PA9 | + | + |
| 10 | PA10 | + | + |
| 11 | PA11 | + | + |
Bold rows indicate IMP-resistant, strong biofilm-producing isolates selected for adhesion assays. +, gene present; −, gene absent.
4. Discussion
Antibiotic resistance is a global threat to public health. The resistance to imipenem has increased over time, which is associated with negative consequences for the treatment of bacterial infections. Several reports have linked biofilm production to antibiotic resistance and the QS phenomenon. The current study showed a strong correlation between imipenem resistance and QS gene distribution, the ability of bacteria to form biofilm, and adhesion to human epithelial cells in P. aeruginosa isolated from burn wound infections. Approximately half of the studied isolates (45.5%) were resistant to imipenem (IMP), which can be explained by the ability of these bacterial isolates to acquire multiple resistance mechanisms [15,16]. P. aeruginosa is a WHO priority bacterium that requires serious research and antimicrobial stewardship programs [3].
The study showed a strong negative correlation between biofilm production and the diameter of the inhibition zone (r = −0.84; P < 0.005), which is consistent with previous studies showing that the biofilm matrix serves as a barrier to antibiotic penetration, reducing the antibiotic's ability to reach bacterial cells. This phenomenon helps bacterial cells persist at the site of infection [17,18]. This finding agrees with previous work demonstrating the role of biofilm formation in clinical and environmental isolates of P. aeruginosa in increasing multidrug resistance rates [18].
Here, the lasR and rhlR genes were detected in 72.7% and 81.8% of P. aeruginosa isolates, respectively, and both genes were co-detected in most isolates. This agrees with previous publications documenting that the LasR/RhIR system regulates different virulence determinants — e.g. elastase, pyocyanin, rhamnolipids, and polysaccharides — which are involved in biofilm formation [5,7].
As the regulation via RhlR can occur with partial independence from LasR activation, it is expected that isolate PA5 presents a profile that is lasR-negative yet rhlR-positive — similar to previously characterized "LasR-null" phenotypes that remain capable of rhlR-mediated virulence and biofilm formation [10]. Likewise, the disruption of QS signaling has been shown to significantly decrease biofilm biomass and lessen the degree of bacterial injury to host epithelial cells [11]. This also supports the biological importance of QS gene carriage in determining disease-causing potential.
The finding that three IMP-resistant, strong biofilm-producing isolates (PA2, PA6, PA10) showed high adhesion to human oral epithelial cells supports the idea that adherence to host epithelial cells via pili, flagella, and lectins represents a critical first step of host colonization and occurs earlier in QS-proficient, biofilm-capable strains [1,14]. These findings suggest that the synergy of QS-controlled biofilm creation, epithelial adhesion, and IMP-resistance mechanisms together enhance the pathogenic ability of P. aeruginosa in burn wound infections.
There are limitations to the current study. First, the limited number of bacterial isolates included weakens the conclusions drawn. Second, the presence of genes does not necessarily mean they are transcriptionally active; therefore, future studies should include gene expression analysis.
5. Conclusion
The study indicates a strong relationship among imipenem (IMP) resistance, the distribution of the QS genes (lasR/rhlR), the ability to form biofilms, and the adhesion of P. aeruginosa isolates to human OMECs. Approximately 50% of the isolates were IMP-resistant and had a strong capacity to form biofilms, demonstrating a robust inverse correlation between biofilm-forming ability and antibiotic response. The rhlR gene was more prevalent than the lasR gene across all tested samples, and both genes were co-detected in most isolates; however, one isolate had a lasR-negative/rhlR-positive genotype, suggesting that the two QS systems are not obligately co-inherited. All three IMP-resistant/strong-biofilm isolates exhibited the highest epithelial cell adhesion, confirming that QS-regulated virulence, biofilm formation, and IMP resistance are interconnected. Taken together, these data support the notion that QS genes may represent novel therapeutic targets for the treatment of biofilm-associated, MDR P. aeruginosa infections in burn wound infections.
6. References
- (2024) In vitro investigation of relationship between quorum-sensing system genes, biofilm forming ability, and drug resistance in clinical isolates of Pseudomonas aeruginosa. BMC Microbiol 24:99. doi: 10.1186/s12866-024-03249-w. PMCID: PMC10962089
- (2019) Antibiotic resistance in Pseudomonas aeruginosa: mechanisms and alternative therapeutic strategies. Biotechnol Adv 37(1):177–192. doi: 10.1016/j.biotechadv.2018.11.013. PMID: 30500353
- (2025) The WHO Bacterial Priority Pathogens List 2024: a prioritisation study to guide research, development, and public health strategies against antimicrobial resistance. Lancet Infect Dis 25(9):1033–1043. doi: 10.1016/S1473-3099(25)00118-5. PMCID: PMC12367593
- (2023) PBP Target Profiling by β-Lactam and β-Lactamase Inhibitors in Intact Pseudomonas aeruginosa: Effects of the Intrinsic and Acquired Resistance Determinants on the Periplasmic Drug Availability. Microbiol Spectr 11(1):e0303822. doi: 10.1128/spectrum.03038-22. PMCID: PMC9927461
- (2011) Pseudomonas aeruginosa: all roads lead to resistance. Trends Microbiol 19(8):419–426. doi: 10.1016/j.tim.2011.04.005. PMID: 21664819
- (2011) Cooperation and cheating in Pseudomonas aeruginosa: the roles of the las, rhl and pqs quorum-sensing systems. ISME J 5(8):1332–1343. doi: 10.1038/ismej.2011.13. PMCID: PMC3146268
- (2013) A quorum-sensing inhibitor blocks Pseudomonas aeruginosa virulence and biofilm formation. Proc Natl Acad Sci U S A 110(44):17981–17986. doi: 10.1073/pnas.1316981110. PMCID: PMC3816427
- (2022) Relationship between biofilm-formation, phenotypic virulence factors and antibiotic resistance in environmental Pseudomonas aeruginosa. Pathogens 11(9):1015. doi: 10.3390/pathogens11091015. PMCID: PMC9503712
- (2013) Biofilm matrix and its regulation in Pseudomonas aeruginosa. Int J Mol Sci 14(10):20983–21005. doi: 10.3390/ijms141020983. PMCID: PMC3821654
- (2018) Biofilm production by clinical isolates of Pseudomonas aeruginosa and structural changes in LasR protein of isolates non biofilm-producing. Braz J Infect Dis 22:129–136. doi: 10.1016/j.bjid.2018.03.003. PMCID: PMC9428190
- (2018) Inhibition of quorum sensing character in Pseudomonas aeruginosa isolates and its effect on biofilm formation and antimicrobial susceptibility profile. Egypt J Med Microbiol 27(1):25–33. doi: 10.21608/ejmm.2018.285134
- (2026) Molecular insights into the oxidative perturbation of VIM-2 metallo-β-lactamase: Active site remodeling restores imipenem susceptibility in Pseudomonas aeruginosa. Microb Pathog 214:108411. doi: 10.1016/j.micpath.2026.108411. PMID: 41771381
- (2018) Performance Standards for Antimicrobial Disk Susceptibility Tests. Clinical and Laboratory Standards Institute, Wayne, PA.
- (2023) Effect of subinhibitory doses of rifaximin on in vitro Pseudomonas aeruginosa adherence and biofilm formation to biotic and abiotic surface models. Polim Med 53:97–103. doi: 10.17219/pim/166584. PMID: 37470308
- (2024) In vitro investigation of relationship between quorum-sensing system genes, biofilm forming ability, and drug resistance in clinical isolates of Pseudomonas aeruginosa. BMC Microbiol 24:99. doi: 10.1186/s12866-024-03249-w. PMCID: PMC10962089
- (2019) Antibiotic resistance in Pseudomonas aeruginosa: Mechanisms and alternative therapeutic strategies. Biotechnol Adv 37(1):177–192. doi: 10.1016/j.biotechadv.2018.11.013. PMID: 30500353
- (2011) Pseudomonas aeruginosa: All roads lead to resistance. Trends Microbiol 19(8):419–426. doi: 10.1016/j.tim.2011.04.005. PMID: 21664819
- (2026) The Effects of Baicalin in Combination with Cefotaxime on the Biofilm and Metabolic Reprogramming of Multidrug-Resistant Pseudomonas aeruginosa. Biomolecules 16(4):598. doi: 10.3390/biom16040598. PMCID: PMC13113927
Author Affiliation
- General Directorate of Al-Rusafa II Education, Ministry of Education, Baghdad, Iraq.
- Department of Zoology, Faculty of Science, Omar Al-Mukhtar University, Libya.
- Department of Biology, Faculty of Education, Omar Al-Mukhtar University, Al-Bayda, Libya.
ORCID IDs:
Talib MM: orcid.org/0009-0003-1954-5166
Attia MS: orcid.org/0000-0002-0901-9467
Abdulrraziq AA: orcid.org/0000-0003-3722-4836
* Correspondence:
Miss Marwa Mohammed Talib (MSc). E-mail: mmt2000uob@gmail.com
General Directorate of Al-Rusafa II Education, Ministry of Education, Baghdad, Iraq.